The Steampunk Forum at Brass Goggles
January 22, 2021, 05:32:46 pm *
Welcome, Guest. Please login or register.
Did you miss your activation email?

Login with username, password and session length
News: Brassgoggles.co.uk - The Lighter Side Of Steampunk, follow @brasstech for forum technical problems & updates.
 
   Home   Blog Help Rules Login Register  
Pages: [1]   Go Down
  Print  
Author Topic: From the Castle "auuaaagg"  (Read 389 times)
Prof Marvel
Zeppelin Captain
*****
Western Sahara Western Sahara


too depressed for words


« on: April 05, 2020, 01:59:22 am »

From the Castle "auuaaagg"
 
Newly published, the Covid-19 RNA sequence -
here is /are The first 265 letters of the Covid-19 RNA

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag


now go thou and anylyze science stuff and make your own vaccine!

Logged

The world is in Hell and I am too depressed for words
Siliconous Skumins
Server Monk
Moderator
Rogue Ætherlord
*
United Kingdom United Kingdom



« Reply #1 on: April 05, 2020, 06:10:44 am »

Oddly enough, that is pretty much the same sound I made while coughing during my early experiment with C-19 (or related strain thereof)....
Logged

[Server Prayer]
Spoiler (click to show/hide)
Banfili
Zeppelin Admiral
******
Australia Australia



« Reply #2 on: April 05, 2020, 07:38:24 am »

I think I will leave it to the "spurts"!
How many letters are there in total, anyway?
Logged
Sorontar
Zeppelin Admiral
******
Australia Australia


All ideas should have wings


WWW
« Reply #3 on: April 05, 2020, 08:07:44 am »

I was actually thinking of the start of the song about this sort of virus. It is much nicer.

https://www.youtube.com/watch?v=NrI-UBIB8Jk

Sorontar
Logged

Sorontar, Captain of 'The Aethereal Dancer'
Advisor to HM Engineers on matters aethereal, aeronautic and cosmographic
http://eyrie.sorontar.com
Pages: [1]   Go Up
  Print  
 
Jump to:  

Powered by MySQL Powered by PHP Powered by SMF 1.1.20 | SMF © 2013, Simple Machines Valid XHTML 1.0! Valid CSS!
Page created in 0.047 seconds with 16 queries.