The Steampunk Forum at Brass Goggles
August 03, 2020, 10:40:37 am *
Welcome, Guest. Please login or register.
Did you miss your activation email?

Login with username, password and session length
News: Support BrassGoggles! Donate once or $3/mo.
 See details here.
 
   Home   Blog Help Rules Login Register  
Pages: [1]   Go Down
  Print  
Author Topic: From the Castle "auuaaagg"  (Read 269 times)
Prof Marvel
Zeppelin Captain
*****
United States United States


learn from history, or be doomed to repeat it


« on: April 05, 2020, 01:59:22 am »

From the Castle "auuaaagg"
 
Newly published, the Covid-19 RNA sequence -
here is /are The first 265 letters of the Covid-19 RNA

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag


now go thou and anylyze science stuff and make your own vaccine!

Logged

Your Humble Servant
~~~~~Professor Algernon Horatio Ubiquitous Marvel The First~~~~~~
President, CEO, Chairman,  and Chief Bottle Washer of
Professor Marvel's Traveling Apothecary and Fortune Telling Emporium

Acclaimed By The Crowned Heads of Europe
Purveyor of Patent Remedies, Snake Oil, Cleaning Supplies, Dry Goods, and Picture Postcards
Offering Unwanted Advice for All Occasions and Providing Useless Items to the Gentry
Since 1822
Siliconous Skumins
Server Monk
Moderator
Rogue Ætherlord
*
United Kingdom United Kingdom



« Reply #1 on: April 05, 2020, 06:10:44 am »

Oddly enough, that is pretty much the same sound I made while coughing during my early experiment with C-19 (or related strain thereof)....
Logged

[Server Prayer]
Spoiler (click to show/hide)
Banfili
Zeppelin Admiral
******
Australia Australia



« Reply #2 on: April 05, 2020, 07:38:24 am »

I think I will leave it to the "spurts"!
How many letters are there in total, anyway?
Logged
Sorontar
Zeppelin Admiral
******
Australia Australia


All ideas should have wings


WWW
« Reply #3 on: April 05, 2020, 08:07:44 am »

I was actually thinking of the start of the song about this sort of virus. It is much nicer.

https://www.youtube.com/watch?v=NrI-UBIB8Jk

Sorontar
Logged

Sorontar, Captain of 'The Aethereal Dancer'
Advisor to HM Engineers on matters aethereal, aeronautic and cosmographic
http://eyrie.sorontar.com
Pages: [1]   Go Up
  Print  
 
Jump to:  

Powered by MySQL Powered by PHP Powered by SMF 1.1.20 | SMF © 2013, Simple Machines Valid XHTML 1.0! Valid CSS!
Page created in 0.023 seconds with 16 queries.